Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3172654
End position: 3172689
Length: 36

DNA sequence
>NC_020895, from 3172654 to 3172689 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGACGCGGAGCCGGTCGAGGAGCCGGACGAGGAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3171404-3173113	Sequence	SHJGH_2704 - preprotein translocase subunit SecD (Protein is coded in complementary strand; from 3173113 to 3171404)