Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3351396
End position: 3351431
Length: 36

DNA sequence
>NC_020895, from 3351396 to 3351431 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TCCCCGTCCTCGTCCTCGTCCTCGTCCTCGTCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3351369-3352073	Sequence	SHJGH_2876 - hypothetical protein (Protein is coded in complementary strand; from 3352073 to 3351369)