Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3485176
End position: 3485211
Length: 36

DNA sequence
>NC_020895, from 3485176 to 3485211 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCCGTCCTCGGCGTCCTCGGCGTCCTCGACGTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3485121-3485834	Sequence	SHJGH_3005 - hypothetical protein (Protein is coded in complementary strand; from 3485834 to 3485121)