Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3663309
End position: 3663344
Length: 36

DNA sequence
>NC_020895, from 3663309 to 3663344 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TGTCCTGACCGGTGTTCTGTCCGGTGTCCTGGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3662399-3663508	Sequence	SHJGH_3172 - hypothetical protein (Protein is coded in complementary strand; from 3663508 to 3662399)