Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3696035
End position: 3696070
Length: 36

DNA sequence
>NC_020895, from 3696035 to 3696070 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGCCAGCCGGTCGGCGAGCCGCTCGGCCAGCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3695464-3696096	Sequence	SHJGH_3201 - hypothetical protein (Protein is coded in complementary strand; from 3696096 to 3695464)