Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3777080
End position: 3777115
Length: 36

DNA sequence
>NC_020895, from 3777080 to 3777115 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCCCTCGCCGGCGCGCTCACCGGCGCCCTCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3776137-3777255	Sequence	SHJGH_3270 - secreted protein