Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 407016
End position: 407051
Length: 36

DNA sequence
>NC_020895, from 407016 to 407051 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GTGTCGCCGGGTCTGTCACCGGGTCTGTCTCCGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 406179-407075	Sequence	SHJGH_0327 - hydrolytic protein (Protein is coded in complementary strand; from 407075 to 406179)