Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 423816
End position: 423851
Length: 36

DNA sequence
>NC_020895, from 423816 to 423851 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TCCCGCTGCCCGGCCCGCTGCCCGGCCCGCTGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 422601-423929	Sequence	SHJGH_0341 - two-component system sensor kinase