Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4467565
End position: 4467600
Length: 36

DNA sequence
>NC_020895, from 4467565 to 4467600 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GTAGAAGCCGTTGCGGAAGCCGTTGTAGAAGCCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4467506-4467757	Sequence	SHJGH_3911 - hypothetical protein (Protein is coded in complementary strand; from 4467757 to 4467506)