Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4509901
End position: 4509936
Length: 36

DNA sequence
>NC_020895, from 4509901 to 4509936 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGGTGACCGCGCCGGGGACGGCGGCGGTGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4509517-4510197	Sequence	SHJGH_3947 - hypothetical protein (Protein is coded in complementary strand; from 4510197 to 4509517)