Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4768423
End position: 4768458
Length: 36

DNA sequence
>NC_020895, from 4768423 to 4768458 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGCGGCCTCCTCGGCCGCCCCCTCGGTGTCCTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4767645-4769693	Sequence	SHJGH_4180 - hypothetical protein (Protein is coded in complementary strand; from 4769693 to 4767645)