Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4884811
End position: 4884846
Length: 36

DNA sequence
>NC_020895, from 4884811 to 4884846 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CTGCGAGGCGCGCGACGAGGCGCGCGGCGGGGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4884345-4884863	Sequence	SHJGH_4265 - cysteine dioxygenase