Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4910264
End position: 4910299
Length: 36

DNA sequence
>NC_020895, from 4910264 to 4910299 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCGGACCGGCTGACGGACCGGCTAGCGGACCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4910286-4911557	Sequence	SHJGH_4289 - two-component system sensor kinase (Protein is coded in complementary strand; from 4911557 to 4910286)