Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5336245
End position: 5336280
Length: 36

DNA sequence
>NC_020895, from 5336245 to 5336280 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGCGTACGGCTCGGCGTACGGCTCCGCGTAGTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5335323-5336588	Sequence	SHJGH_4683 - integral membrane protein (Protein is coded in complementary strand; from 5336588 to 5335323)