Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5830706
End position: 5830741
Length: 36

DNA sequence
>NC_020895, from 5830706 to 5830741 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGACGTCGCCGTAGCCGTCGCCGTTGACGTCGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5830123-5831535	Sequence	SHJGH_5126 - integrin-like protein (Protein is coded in complementary strand; from 5831535 to 5830123)