Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6028155
End position: 6028190
Length: 36

DNA sequence
>NC_020895, from 6028155 to 6028190 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCCCCGCGAGAAGGCCCGCGAGGAGCCCCGCGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6027812-6028267	Sequence	SHJGH_5308 - integral membrane protein (Protein is coded in complementary strand; from 6028267 to 6027812)