Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 605854
End position: 605889
Length: 36

DNA sequence
>NC_020895, from 605854 to 605889 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGTCGTCGTCCTCGTCGTCCTCGTCGTCCTCGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 604023-606338	Sequence	SHJGH_0498 - hypothetical protein (Protein is coded in complementary strand; from 606338 to 604023)