Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6195711
End position: 6195746
Length: 36

DNA sequence
>NC_020895, from 6195711 to 6195746 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGTGGCGGGGGCGGCGGCGGTGCCGGAGGCGGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6194833-6195819	Sequence	SHJGH_5455 - sugar hydrolase (Protein is coded in complementary strand; from 6195819 to 6194833)