Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6601226
End position: 6601261
Length: 36

DNA sequence
>NC_020895, from 6601226 to 6601261 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 AGCGCCGCCTCCACGGCCGCCTCCAGCGCCGCCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6601163-6602794	Sequence	SHJGH_5823 - hypothetical protein (Protein is coded in complementary strand; from 6602794 to 6601163)