Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6835784
End position: 6835819
Length: 36

DNA sequence
>NC_020895, from 6835784 to 6835819 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GACCGGGAACGCGCCCGGGAAGGCGCCCGAGAACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6834799-6835881	Sequence	SHJGH_6038 - ABC transporter system integral membrane protein