Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7221045
End position: 7221080
Length: 36

DNA sequence
>NC_020895, from 7221045 to 7221080 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGCCCCGCGCGCCGCGCCGCCCGCCGCCCCACGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7220579-7221841	Sequence	SHJGH_6375 - transcriptional regulator (Protein is coded in complementary strand; from 7221841 to 7220579)