Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7417145
End position: 7417180
Length: 36

DNA sequence
>NC_020895, from 7417145 to 7417180 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCCAGGGCCAGGGCCAGGGCCAGGGCCAGGGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7416984-7419710	Sequence	SHJGH_6555 - translation initiation factor IF-2