Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7931084
End position: 7931119
Length: 36

DNA sequence
>NC_020895, from 7931084 to 7931119 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCCCGTCGTCCCCGTCCTCCCCGTCGTCCCCGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7929828-7931138	Sequence	SHJGH_6977 - xylitol oxidase (Protein is coded in complementary strand; from 7931138 to 7929828)