Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 8372469
End position: 8372504
Length: 36

DNA sequence
>NC_020895, from 8372469 to 8372504 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 ACCGACGACCCCGACGACCCCGACGACCCCGACGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8371390-8372526	Sequence	SHJGH_7385 - fatty acid-CoA racemase