Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 8523779
End position: 8523814
Length: 36

DNA sequence
>NC_020895, from 8523779 to 8523814 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGGGCGAGGGGGCGGGCGAGGGGCCGGGGGTGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8522282-8523820	Sequence	SHJGH_7524 - amino acid/metabolite permease (Protein is coded in complementary strand; from 8523820 to 8522282)