Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 8539523
End position: 8539558
Length: 36

DNA sequence
>NC_020895, from 8539523 to 8539558 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCGTGGGAGTACCCCTGGGAGTACGTCTGGGAGTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8539506-8541905	Sequence	SHJGH_7536 - putative glycosyl hydrolase