Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 9089328
End position: 9089363
Length: 36

DNA sequence
>NC_020895, from 9089328 to 9089363 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CTCGCCGTCCACCTCGCCGTGCAACTCGTCGTCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9087946-9089691	Sequence	SHJGH_7955 - putative integral membrane protein