Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 9365952
End position: 9365987
Length: 36

DNA sequence
>NC_020895, from 9365952 to 9365987 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGTCGCTGGTCATGCCGCTGGTCATGTCACTGGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9364337-9365989	Sequence	SHJGH_8206 - hypothetical protein (Protein is coded in complementary strand; from 9365989 to 9364337)
ORF... 9365986-9367002	Sequence	SHJGH_8207 - magnesium or manganese-dependent protein phosphatase (Protein is coded in complementary strand; from 9367002 to 9365986)