Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 9712817
End position: 9712852
Length: 36

DNA sequence
>NC_020895, from 9712817 to 9712852 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCGCAGCGCTTCGCGCAGGGCCTCGCGCATCGCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9711840-9712919	Sequence	SHJGH_8521 - pyruvate dehydrogenase E1 component,beta subunit (Protein is coded in complementary strand; from 9712919 to 9711840)