Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6932956
End position: 6932994
Length: 39

DNA sequence
>NC_020895, from 6932956 to 6932994 (39 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCCGTCTGAGCACGCGGTCTGAGCATGCCGTCTGAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 6932712-6932966	Sequence	SHJGH_6125 - hypothetical protein