Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 698820
End position: 698858
Length: 39

DNA sequence
>NC_020895, from 698820 to 698858 (39 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGTGAATCGGTACGGTGAATCGGCGTGGTGAATCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 698664-698897	Sequence	SHJGH_0582 - hypothetical protein (Protein is coded in complementary strand; from 698897 to 698664)