Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7861756
End position: 7861794
Length: 39

DNA sequence
>NC_020895, from 7861756 to 7861794 (39 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCGCGCCTGCTCCGCGCGCCTGCTCCGCGCGCCTGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 7861794-7863044	Sequence	SHJGH_6916 - 3-hydroxyacyl-CoA dehydrogenase (Protein is coded in complementary strand; from 7863044 to 7861794)