Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 8357338
End position: 8357379
Length: 42

DNA sequence
>NC_020895, from 8357338 to 8357379 (42 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 AGCCGTAGCCGTAGCCGTAGCCGTAGCCGTAGCCGTAGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 8356156-8357346	Sequence	SHJGH_7370 - glutathione-dependent aldehyde dehydrogenase