Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2639254
End position: 2639298
Length: 45

DNA sequence
>NC_020895, from 2639254 to 2639298 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCCTCACCACGACGGCCATCACCACGACGGCCATCACCACCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2638299-2639498	Sequence	SHJGH_2212 - hypothetical protein