Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3077910
End position: 3077954
Length: 45

DNA sequence
>NC_020895, from 3077910 to 3077954 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TGTCCGCTCCCGGCCCATCCGCTCCCAGCCCGTCCGCTCCCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3077871-3078596	Sequence	SHJGH_2617 - putative integral membrane protein