Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3638389
End position: 3638433
Length: 45

DNA sequence
>NC_020895, from 3638389 to 3638433 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 ACCGCGAAGAAGGCGCCGGCGAAGAAGGCACCGGCGAGGAAGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3637340-3638446	Sequence	SHJGH_3151 - hypothetical protein