Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3830372
End position: 3830416
Length: 45

DNA sequence
>NC_020895, from 3830372 to 3830416 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCCCATCGGGCCCTGACCCATCGGACCCTGGCCCATCGGGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3829678-3830805	Sequence	SHJGH_3322 - hypothetical protein (Protein is coded in complementary strand; from 3830805 to 3829678)