Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4338746
End position: 4338790
Length: 45

DNA sequence
>NC_020895, from 4338746 to 4338790 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TCCCGGTCACCGGAGTCCCGGTCACCGAGATCCCGGTCGTCGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4337591-4338877	Sequence	SHJGH_3799 - transmembrane efflux protein