Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4515791
End position: 4515835
Length: 45

DNA sequence
>NC_020895, from 4515791 to 4515835 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGTGATCCCGCACGTCGTGACCGCGCACATCGTCACCCCGCACGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4515715-4515855	Sequence	SHJGH_3953 - hypothetical protein