Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4568869
End position: 4568913
Length: 45

DNA sequence
>NC_020895, from 4568869 to 4568913 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GAAGGCCCGCGCCCCGGAGACCGGCGCCCCGGAGGCCCGCACCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4568769-4569572	Sequence	SHJGH_4000 - putative TetR-family transcriptional regulator