Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5013203
End position: 5013247
Length: 45

DNA sequence
>NC_020895, from 5013203 to 5013247 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGAGGCCGGTCCTGCGGTGGCCGGTCCCCCGGCGACTGGTCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5011461-5013296	Sequence	SHJGH_4378 - hypothetical protein (Protein is coded in complementary strand; from 5013296 to 5011461)