Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5119823
End position: 5119867
Length: 45

DNA sequence
>NC_020895, from 5119823 to 5119867 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 AGACGGACCTGCGGGAGGCGGACCTGACGGAGGCGGACCTGAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5119469-5120056	Sequence	SHJGH_4470 - pentapeptide repeat protein