Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5348725
End position: 5348769
Length: 45

DNA sequence
>NC_020895, from 5348725 to 5348769 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 ACCGGGACCACCAGTGCCGGAACCACCCGTGCCGGGATCACCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 5348110-5348766	Sequence	SHJGH_4696 - ABC transport system transmembrane protein (Protein is coded in complementary strand; from 5348766 to 5348110)