Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5669791
End position: 5669835
Length: 45

DNA sequence
>NC_020895, from 5669791 to 5669835 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 AGCCGCCGCCGTTGTCGCCGCCGCCGTTGTTGCCGCCGCCGAAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5669772-5671766	Sequence	SHJGH_4982 - serine/threonine protein kinase (Protein is coded in complementary strand; from 5671766 to 5669772)