Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5685990
End position: 5686034
Length: 45

DNA sequence
>NC_020895, from 5685990 to 5686034 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GTAGCCCGGGCGCCGGTCGGCCGGACGCCGGTCGGCCGGGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 5685665-5685994	Sequence	SHJGH_4993 - hypothetical protein