Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5685995
End position: 5686039
Length: 45

DNA sequence
>NC_020895, from 5685995 to 5686039 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGGGCGCCGGTCGGCCGGACGCCGGTCGGCCGGGCGCCGGTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 5686037-5686717	Sequence	SHJGH_4994 - acyl-CoA dehydrogenase (Protein is coded in complementary strand; from 5686717 to 5686037)