Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5954463
End position: 5954507
Length: 45

DNA sequence
>NC_020895, from 5954463 to 5954507 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCCCGGCGAAGAAGACCGCCGCCAAGAAGACGGCCGCGAAGAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5951769-5954600	Sequence	SHJGH_5231 - DNA topoisomerase I