Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6008015
End position: 6008059
Length: 45

DNA sequence
>NC_020895, from 6008015 to 6008059 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TACGACAACCAGGGGTACGACGACCAGGGGTACGACGACCAGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6007134-6008153	Sequence	SHJGH_5289 - hypothetical protein