Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6008022
End position: 6008066
Length: 45

DNA sequence
>NC_020895, from 6008022 to 6008066 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 ACCAGGGGTACGACGACCAGGGGTACGACGACCAGGGGTACGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6007134-6008153	Sequence	SHJGH_5289 - hypothetical protein