Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 609779
End position: 609823
Length: 45

DNA sequence
>NC_020895, from 609779 to 609823 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCGTCGTACGGATCCTCGTCGTACGGACCCTCGTCGGGCGGATCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 607757-609853	Sequence	SHJGH_0500 - putative magnesium or manganese-dependent protein (Protein is coded in complementary strand; from 609853 to 607757)